![subject](/tpl/images/cats/biologiya.png)
Biology, 15.04.2020 03:54 shacarabrown49
You perform Sanger sequencing on a small fragment of the human genome and obtain the following small sequence read: 5' AGGCTTAAGCTTAATCGGGCTAT 3'. In order to determine if this sequence might be within the coding region of a gene, you examine it for open reading frames. How many open reading frames exist that go all the way through this DNA fragment?
![ansver](/tpl/images/cats/User.png)
Answers: 1
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 21:30
Which sentence is an example of a strong conclusion to an autobiography? a. i stayed after school three days in a row to practice onstage in the auditorium. b. i knew i would have to practice all week to memorize my dance for the recital. c. after the recital was over, i knew practicing was worth it, and i was looking forward to my next big challenge. d. on opening night, i danced in front of a packed auditorium.
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 10:30
Apopulation of rabbits live in a local forest. some had a mutation for a large body and long legs. the graph below shows the number of both the mutant and the normal rabbits over 5 generations. which of the following statements is true for this scenario? question 7 options: the rabbits with the mutation were more successful with restricted food than the normal rabbits. both sets of rabbits were equally successful with the restricted food source.i the normal rabbits were more successful with restricted food than the rabbits with the mutation. the graph does not let us know which rabbit was more successful.
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 15:20
What is required in the genotype of an individual to show a recessive trait? a.two recessive alleles b.at least one recessive allele c.no recessive alleles
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 18:30
Which rate indicates the number of children that would be born per women if she were to live to the end of her child-bearing years
Answers: 2
You know the right answer?
You perform Sanger sequencing on a small fragment of the human genome and obtain the following small...
Questions
![question](/tpl/images/cats/mkx.png)
![question](/tpl/images/cats/en.png)
English, 28.08.2019 04:40
![question](/tpl/images/cats/obshestvoznanie.png)
Social Studies, 28.08.2019 04:40
![question](/tpl/images/cats/mat.png)
Mathematics, 28.08.2019 04:40
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/istoriya.png)
History, 28.08.2019 04:50
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/obshestvoznanie.png)
Social Studies, 28.08.2019 04:50
![question](/tpl/images/cats/en.png)
English, 28.08.2019 04:50
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/obshestvoznanie.png)
Social Studies, 28.08.2019 04:50
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/fizika.png)
Physics, 28.08.2019 04:50
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 28.08.2019 04:50
![question](/tpl/images/cats/geografiya.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 28.08.2019 04:50
![question](/tpl/images/cats/istoriya.png)
History, 28.08.2019 04:50