Nebula - protostar - main sequence star. The hydrogen gas in the nebula is pulled together by gravity and it begins to spin and as the gas spins faster, it heats up and becomes a protostar. Eventually the temperature reaches 15,000,000 degrees. At this point, in a main sequence star, what occurs?

Consider the last statement in the prompt: "people take such environmental factors into account in their choices when deciding where to live." do all people have a choice as to where they live? what factor plays a key role in this decision and may therefore play a large role in determining quality of life?

Match the pollutants. 1. a chlorofluorocarbon smoke 2. a biodegradable organophosphate insecticide freon 3. particle pollution paint 4. hazardous waste monoxide 5. carbon is completely burned malathion 6. carbon is incompletely burned dioxide

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?