![subject](/tpl/images/cats/biologiya.png)
Nebula - protostar - main sequence star. The hydrogen gas in the nebula is pulled together by gravity and it begins to spin and as the gas spins faster, it heats up and becomes a protostar. Eventually the temperature reaches 15,000,000 degrees. At this point, in a main sequence star, what occurs?
![ansver](/tpl/images/cats/User.png)
Answers: 1
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 19:50
Consider the last statement in the prompt: "people take such environmental factors into account in their choices when deciding where to live." do all people have a choice as to where they live? what factor plays a key role in this decision and may therefore play a large role in determining quality of life?
Answers: 3
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 06:30
Match the pollutants. 1. a chlorofluorocarbon smoke 2. a biodegradable organophosphate insecticide freon 3. particle pollution paint 4. hazardous waste monoxide 5. carbon is completely burned malathion 6. carbon is incompletely burned dioxide
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 13:20
Choose the incorrect statement (a) the motor end plate membrane is only capable of generating graded potentials, but it is contiguous with the skeletal muscle sarcolemma, which can generate action potentials. (b) propagation of an action potential through the t-tubules into the sarcoplasmic reticulum triggers the release of ca++ into the cytoplasm of a skeletal muscle fiber. (c) the generation of suprathreshold endplate potentials in multiple muscle fibers could be due to the increased frequency of action potential generation at the axon hillock of a single motor neuron. (d) a greater amount of ach would be found in the presynaptic vesicles of a motor unit that fired several action potentials after exposure to botulinum toxin, than in a motor unit that fired several action potentials after exposure to the venom of the krait snake (which contains α-bungarotoxin).
Answers: 2
You know the right answer?
Nebula - protostar - main sequence star. The hydrogen gas in the nebula is pulled together by gravit...
Questions
![question](/tpl/images/cats/obshestvoznanie.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 30.03.2021 04:50
![question](/tpl/images/cats/en.png)
English, 30.03.2021 04:50
![question](/tpl/images/cats/mat.png)
Mathematics, 30.03.2021 04:50
![question](/tpl/images/cats/himiya.png)
Chemistry, 30.03.2021 04:50
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 30.03.2021 04:50
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/obshestvoznanie.png)
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/obshestvoznanie.png)
Social Studies, 30.03.2021 04:50
![question](/tpl/images/cats/mat.png)
Mathematics, 30.03.2021 04:50
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/obshestvoznanie.png)
Social Studies, 30.03.2021 04:50
![question](/tpl/images/cats/mat.png)
Mathematics, 30.03.2021 04:50
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 30.03.2021 04:50