You perform Sanger sequencing on a small fragment of the human genome and obtain the following small sequence read: 5' AGGCTTAAGCTTAATCGGGCTAT 3'. In order to determine if this sequence might be within the coding region of a gene, you examine it for open reading frames. How many open reading frames exist that go all the way through this DNA fragment? (Recall that the stop codons are 5' TAA, 5' TAG, and 5' TGA.)

(drag each tile to the correct identify which questions can be answered by what can be answered by science or which cannot. -is it right or wrong to use genetic engineering to produce new food products? -what are the most common social settings that tend to produce accomplished artists? -if a new gene is added to the genome of a tomato species, will that species be more resistant to insects? -should humans use biotechnology to bring extinct organisms from the fossil record back to life? -do the types of organisms found in the fossil record appear in consistent sequences in different parts of the world? -are michelangelo's paintings more impressive than rembrandt's?

Which phase of the cell cycle ensures that identical copies of the dna are made for daughter cells?

What happens when two nitrogen atoms share electrons