Energy resources, the ease of attaining them, and the methods in which they are used, directly relate to economic growth of a country
as well the overall many other aspects of life within that country. All but one is directly related to energy and sustainable
development. That is
A) Family size
B) Per capita income
C) The health of the citizens
D) Availability of clean water

Iron reacts with oxygen to produce iron oxide (rust). this reaction is represented in an equation as 4fe + xo2 → 2fe2o3. identify the value of x that will balance the equation.

Where can dna be found in a prokaryotic cell

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?