Jalen observes a pond ecosystem near his home and records the changes he observes over a season for his science project. Ecosystems have important value for the organisms within them.

Which of the following determines whether an ecosystem is healthy? Choose the two that apply.

A.
a food chain with several members

B.
the number of organisms in an area

C.
the variety of species in an area

D.
many natural resources

Anormal appearing couple is found to be heterozygous recessive for albinism both have the genotype aa the gene responsible for albinism is recessive to the normal pigment-producing gene what are the changes of their children being albino

_tissues respond quickly to outside stimuli a) epithelia b)nervous c)muscular d)muscular and nervous

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?