![subject](/tpl/images/cats/biologiya.png)
Biology, 27.04.2020 01:38 claudiseliss4910
Watersheds may be contaminated by fertilizers and other pollutants. When these substances enter a waterway, they can cause algal blooms,
which are rapid overgrowths of algae. When the algae die, the decay uses up a large portion of dissolved oxygen. Declining oxygen levels can
then cause large die-offs of animals in the waterway.
What will an algal bloom in a watershed most likely cause?
![ansver](/tpl/images/cats/User.png)
Answers: 1
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 23:10
When elements that form a mineral dissolve in hot water, they form a mixture called a(n) a)geode b)vein c)evaporation d)crystallization e)magma f)lava g)solution h)gem
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 02:00
How is ribosomal rna useful as a molecular clock? a. a large portion of the dna ring is not vital to structure or function, allowing it to accumulate neutral mutations. b. its rate of mutation increases over time as organisms continue to evolve and differentiate from each other. c. a slow mutation rate makes it useful for determining evolutionary relationships between ancient species. d. it is only found in select organisms, making it easier to compare relationships between species that have it.
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 07:30
Nh3 +02-no + h20 is unbalanced what is the balanced equation
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Watersheds may be contaminated by fertilizers and other pollutants. When these substances enter a wa...
Questions
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 06.02.2021 14:30
![question](/tpl/images/cats/mat.png)
Mathematics, 06.02.2021 14:30
![question](/tpl/images/cats/en.png)
English, 06.02.2021 14:30
![question](/tpl/images/cats/istoriya.png)
History, 06.02.2021 14:30
![question](/tpl/images/cats/himiya.png)
Chemistry, 06.02.2021 14:30
![question](/tpl/images/cats/himiya.png)
![question](/tpl/images/cats/fizika.png)
Physics, 06.02.2021 14:30
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/obshestvoznanie.png)
Social Studies, 06.02.2021 14:30
![question](/tpl/images/cats/mat.png)
Mathematics, 06.02.2021 14:30
![question](/tpl/images/cats/mat.png)
Mathematics, 06.02.2021 14:30
![question](/tpl/images/cats/mat.png)
Mathematics, 06.02.2021 14:30
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 06.02.2021 14:30
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/en.png)
English, 06.02.2021 14:40
![question](/tpl/images/cats/biologiya.png)
Biology, 06.02.2021 14:40