The cholera toxin, an AB exotoxin, attaches an ADP-ribose group to the host's stimulatory G factor (Gs). The normal function of Gs is to stimulate the host's adenylate cyclase, which produces the second messenger molecule cAMP. This toxin-mediated ADP-ribosylation of Gs has which of the following effects?a. inactivation of Gs, causing a decrease in cAMP levels and resulting in decreased ion transport from the infected host cell. b. constant activation of Gs, causing an increase in cAMP levels and resulting in decreased ion transport from the infected host cell. c. inactivation of Gs, causing a decrease in cAMP levels and resulting in increased ion transport from the infected host cell. d. constant activation of Gs, causing an increase in cAMP levels and resulting in increased ion transport from the infected host cell.

Which best describes a rhinovirus? o a. a virus that causes a common cold o b. a protective shell around a virus o c. a tube the comes off a virus o d. a piece of dna transferred by a virus

Which of the following is an example of competition that could be found in a forest? question 14 options: deer eat berries and their droppings seed new areas creating more berry bushes two fox populations utilize the same rabbit population as their main food source two hawk populations utilize the same scorpion population as their main food source lack of sunlight due to changes in the seasons restricts the growth of certain plants

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?