BRAINLIEST TO WHOEVER ANSWERS THIS QUESTION CORRECTLY
Scientists publish a revised list...
BRAINLIEST TO WHOEVER ANSWERS THIS QUESTION CORRECTLY
Scientists publish a revised list of dangerous greenhouse gases. Which statements describe the importance of this information? Check all that apply.
It confirms the need for oil fracking to produce energy.
It determines the connection this information has to glacier melting.
It assesses how many coal power plants to add in a community.
It supports laws that protect the public from environmental hazards.
It leads to new jobs that search for innovative ways to control emissions.
Answers: 1
Biology, 22.06.2019 03:00
Which statement best describes the relationship between an allele and a gene? question 1 a. an allele is a variation of a gene that can be expressed as a phenotype. b. an allele is the part of a gene that attaches to messenger rna molecules. c. an allele is a segment of a dna molecule that controls replication of a gene.
Answers: 3
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 16:30
Organize the following objects from lowest volume to highest volume
Answers: 2
Biology, 23.06.2019 00:30
The system breaks down the food we eat, while the system transports the tiny food particles to each cell in the body. a. muscular; circulatory b. digestive; respiratory c. circulatory; digestive d. digestive; circulatory
Answers: 1
History, 09.07.2019 14:10
Physics, 09.07.2019 14:10
Chemistry, 09.07.2019 14:10
Mathematics, 09.07.2019 14:10
Mathematics, 09.07.2019 14:10
Mathematics, 09.07.2019 14:10
Physics, 09.07.2019 14:10
Mathematics, 09.07.2019 14:10
Physics, 09.07.2019 14:10