Robert is studying a long list of letters. The letters represent the order of nitrogenous bases in a molecule of mRNA. The first several bases in the list are shown below. AUGCCACAGGUUCAUCCGAA… To identify the amino acid sequence encoded by the mRNA, which would be the most useful first step for Robert to follow?

Post the question

This is s cute awee : (( . well if she's showing you signs that she may like you , then shoot your shot ! don't be afraid . & if you're unsure that she's giving you these signs , then wait out for a little bit . most girls are different . some may act really sweet , but only bc you're a good friend of hers . that , or she might like you . you just never know . but i think you should sit down with her & tell her how you feel . but don't be awkward & shy . just be straight up & tell her how you feel . if the feelings aren't mutual , then don't cry about it . you need to respect her decision & look for others in the world . feelings can be difficult & confusing , but don't be afraid to show them . i say you play it out & if you're still unsure about it , talk to her . - rach