subject
Biology, 21.05.2020 07:04 katherinegvz

Would this be benefical and what do u think some of the unexpected concequences might be

ansver
Answers: 1

Another question on Biology

question
Biology, 22.06.2019 05:50
Acell in the human nervous system whose primary function is to form myelin and the blood-brain barrier, respond to injury, remove debris, and enhance learning and memory is called a(n) cell.
Answers: 2
question
Biology, 22.06.2019 12:00
The earth's oceans are made up of chlorine, and trace elements. a) carbon, oxygen b) oxygen, silicon c) hydrogen, oxygen d) nitrogen, oxygen
Answers: 2
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 12:00
Label the steps for protein synthesis in order, beginning with the first steponce the protein is made, the gene for a particular trait is expressedmrna joins the ribosome, and the anticodons from trna join mrna to form a chain ofamino acidsrna polymerase unzips dna and free rna nucleotides join dna to form mrnav a chain of amino acids is formed from peptide bonds, creating a proteinmrna is transported from the nucleus of the cell to the ribosomes of the cell.
Answers: 1
You know the right answer?
Would this be benefical and what do u think some of the unexpected concequences might be...
Questions
question
Mathematics, 03.02.2020 09:43
question
Computers and Technology, 03.02.2020 09:43
Questions on the website: 13722359