subject
Biology, 11.10.2019 05:30 BardiFan

In what ways are cellulose and starch similar to each other and in what ways are they different? be specific in your comparison, being sure to discuss both structure and function.

ansver
Answers: 1

Another question on Biology

question
Biology, 22.06.2019 08:30
Gene expression is the activation of a gent that results in a question 1 options: protein dna mitochondria
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 16:30
How did the club fungi get its name? a. it is named for the club-shaped seeds it produces. b. it is named for the way individual species grow together in small groups called “clubs.” c. it is named for the club-shaped area where it produces spores. d. it is named for the club-like mechanism it uses to kill its prey.
Answers: 2
question
Biology, 22.06.2019 17:50
Si units are the modern form of the
Answers: 1
You know the right answer?
In what ways are cellulose and starch similar to each other and in what ways are they different? be...
Questions
question
Mathematics, 08.04.2021 06:10
question
Mathematics, 08.04.2021 06:10
question
Chemistry, 08.04.2021 06:10
Questions on the website: 13722359