subject
Biology, 17.06.2020 20:57 laylay120

Two heterozygous individuals reproduce and have four offspring, which answer includes all of the possible genotypes of offspring?
A TT, tt
B. TT, Tt tt
C. TT, TT
D. Tt

ansver
Answers: 2

Another question on Biology

question
Biology, 22.06.2019 07:30
9. the history of life on earth is recorded in
Answers: 2
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 13:00
What is the role of dna ligase in the elongation of the lagging strand during dna replication?
Answers: 1
question
Biology, 22.06.2019 13:10
Match the correct terms to their descriptions a system in which only energy but not matter is exchanged frozen water in snow part of geosphere that includes only soil a thin layer between the troposphere and the stratosphere cryosphere tropopause closed system pedosphere
Answers: 2
You know the right answer?
Two heterozygous individuals reproduce and have four offspring, which answer includes all of the po...
Questions
question
History, 23.10.2019 22:00
question
Social Studies, 23.10.2019 22:00
Questions on the website: 13722361