7.
A sheep germ cell has a diploid number of 54 chromosomes,
Complete the following table by...
Biology, 19.06.2020 04:57 VgCarlos2596
7.
A sheep germ cell has a diploid number of 54 chromosomes,
Complete the following table by stating the number of cells, the number of chromatids,
and the number of chromosomes at the end of each of the following stages of meiosis
and mitosis.
Meiosis:
Telophase 1
Prophase
Mitosis:
Telophase
Number of Cells
Number of Chromatids
Number of Chromosomes
For each stage.
Answers: 2
Biology, 22.06.2019 08:50
What processes take place before the mature mrna exits the nucleus?
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 13:00
Need with these questions . need the answers in a rush for these questions are the answers i put down are correct or not? ?
Answers: 1
Biology, 22.06.2019 14:10
Pls the table below shows the role of different substances during photosynthesis. substance role during photosynthesis glucose stores chemical energy water combines with glucose to form carbon dioxide chlorophyll traps sunlight which of the following statements would correct one of the roles listed in the table? glucose combines with carbon to form water. chlorophyll reacts with light to produce carbon dioxide. water combines with carbon dioxide during photosynthesis. chlorophyll stores chemical energy needed for photosynthesis.
Answers: 2
Mathematics, 30.10.2019 01:31
Mathematics, 30.10.2019 01:31
History, 30.10.2019 01:31
History, 30.10.2019 01:31
Mathematics, 30.10.2019 01:31
Biology, 30.10.2019 01:31
English, 30.10.2019 01:31
Mathematics, 30.10.2019 01:31
Biology, 30.10.2019 01:31
Mathematics, 30.10.2019 01:31
Health, 30.10.2019 01:31