![subject](/tpl/images/cats/biologiya.png)
Biology, 18.06.2020 12:57 hannahbear16841
A biologist measures the allele frequencies of pea plants in a very controlled
environment. The plants can either have a dominant tall allele (7) or a
recessive short allele (t). Which of the following would be a reason that this
population is not at Hardy-Weinberg equilibrium?
O A. The pea flowers are pollinated at random.
O B. Both alleles ensure equal survival.
C. One plant pollinates more flowers than the others.
O D. There are no mutations in the alleles for height.
![ansver](/tpl/images/cats/User.png)
Answers: 3
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 19:30
Which statement is true about the cell theory? a) it is well-supported by evidence. b) it is unchangeable and permanent.
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 08:30
If the rna molecule in a human has the nucleotide sequence of guu, this would the amino acid valine would be needed to make the protein. how would this cha process was occurring in a mushroom?
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 13:00
Which soil would most likely be found in the arctic? andisols gelisols histosols spodosols
Answers: 1
You know the right answer?
A biologist measures the allele frequencies of pea plants in a very controlled
environment. The pla...
Questions
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/istoriya.png)
History, 16.12.2020 22:10
![question](/tpl/images/cats/mat.png)
Mathematics, 16.12.2020 22:10
![question](/tpl/images/cats/himiya.png)
Chemistry, 16.12.2020 22:10
![question](/tpl/images/cats/geografiya.png)
![question](/tpl/images/cats/health.png)
Health, 16.12.2020 22:10
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 16.12.2020 22:10
![question](/tpl/images/cats/himiya.png)
Chemistry, 16.12.2020 22:10
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/obshestvoznanie.png)
Social Studies, 16.12.2020 22:10
![question](/tpl/images/cats/fizika.png)
Physics, 16.12.2020 22:10
![question](/tpl/images/cats/mkx.png)
Arts, 16.12.2020 22:10
![question](/tpl/images/cats/en.png)
English, 16.12.2020 22:10
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/health.png)
![question](/tpl/images/cats/biologiya.png)
Biology, 16.12.2020 22:10
![question](/tpl/images/cats/istoriya.png)
History, 16.12.2020 22:10
![question](/tpl/images/cats/health.png)
Health, 16.12.2020 22:10