![subject](/tpl/images/cats/biologiya.png)
The tetrapeptide Ac-cysteine-alanine-glutamine-argin ine has its N-terminus blocked by acetylation. Its C-terminal pKa is 4.30. Its side chain pKas are 8.3 and 12.5. Use this information to answer questions 14-21. Which of the following is this peptide sequence written in single letter abbreviations?
A. Ac-CANR
B. Ac-CAGR
C. Ac-SANR
D. Ac-CANG
E. None of the above
![ansver](/tpl/images/cats/User.png)
Answers: 3
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 19:30
Place the steps tor the formation of the enzyme pepsinogen in correct order
Answers: 1
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 09:00
This is a typical grassland food web. it is also a small picture of an important cycle on earth: the carbon cycle. describe how the carbon gets into this food web. a) bacteria and fungi, the decomposers, recycle carbon from dead organisms. b) carbon is found in the grass and is passed from one level to the next in this food web. eliminate c) all living things give off carbon dioxide as a by-product of respiration and it is released into the atmosphere. d) plants use carbon dioxide as a reactant in photosynthesis, to make usable chemical energy in the form of a sugar.
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
The tetrapeptide Ac-cysteine-alanine-glutamine-argin ine has its N-terminus blocked by acetylation....
Questions
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/fizika.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/fizika.png)
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/informatica.png)
Computers and Technology, 16.11.2019 02:31
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/fizika.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/ap.png)
Advanced Placement (AP), 16.11.2019 02:31
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/en.png)