Bacteria with the ability to break down certain types of plastic are placed with a colony of E. coli bacteria that lack this ability. Plasmid transfer occurs between the two colonies of bacteria and some of the E. coli gain the ability to break down plastic as well. What inference can be drawn about the nature of plasmids from this observation? A. Plasmids are nucleic acids which can pass on traits. B. Plasmids are lipids which provide energy for the cell. C. Plasmids are proteins which build tissues. D. Plasmids are carbohydrates which provide structural support.

How does photosynthesis show the conservation of mass and energy?

You have just sequenced a new protein found in mice and observe that sulfur-containing cysteine residues occur at regular intervals. what is the significance of this finding? it will be important to include cysteine in the diet of the mice. cysteine residues are required for the formation of α helices and β pleated sheets. cysteine residues are involved in disulfide bridges that form tertiary structure. cysteine causes bends, or angles, to occur in the tertiary structure of proteins.

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?