During mismatch repair, it is essential for the cell to be able to distinguish between the old template DNA strand and the newly synthesized DNA strand in order to make the appropriate correction of a mispairing created during DNA replication. How is this accomplished In E. coli?
Answers: 3
Biology, 21.06.2019 14:30
Which one of these is a involving in both sexual and asexual reproduction
Answers: 2
Biology, 21.06.2019 21:50
What is the name for a substance formed in a chemical reaction
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 18:00
The diagram below shows the layers of a rock having a trilobite: a rock column labeled rock is shown. the column has three layers. the bottommost layer of the rock has one shaded rhomboid shape, the middle layer has a rhombus with a diagonal along with two identical organisms marked as, trilobite, in the key, the top layer has two semicircles. a key is shown on the right side of the diagram. the shaded rhombus is marked as a, the rhombus with the diagonal is marked as b, the semicircle is marked as c which statement about the rock fossils is true?
Answers: 2
During mismatch repair, it is essential for the cell to be able to distinguish between the old templ...
English, 05.05.2020 23:15
Social Studies, 05.05.2020 23:15
Mathematics, 05.05.2020 23:15
Biology, 05.05.2020 23:15
Mathematics, 05.05.2020 23:15
Mathematics, 05.05.2020 23:15