Ethyl methane sulfonate is a chemical mutagen that modifies bases in DNA. This agent causes C to be mutated to T. What is the outcome if this type of mutation occurs in the bases of codon 5 in the sequence of the following sense strand of DNA? GTCACCGGTCTATACATAAGC
A) There would be a change in DNA sequence but no change in the protein sequence due to the redundancy of the genetic code.
B) There would be a mis-sense mutation, resulting in the substitution of an Asn for a His residue in the protein.
C) There would be a non-sense mutation, resulting in the synthesis of a truncated protein.
D) Both B and C are possible outcomes.
Answers: 1
Biology, 22.06.2019 00:10
Recent research by marine biologists suggests that bottlenose dolphins have names for themselves. scientists played sounds they had identified as the names of particular dolphins, putting them through a synthesizer so that they did not sound like the voices of particular dolphins. the researchers found that dolphins would respond to the names of other dolphins that they were related to or associated with, but they ignored the names of strangers. this discovery suggests a much greater degree of self-awareness in aquatic mammals than was previously suspected. if this research holds up, what does it suggest about dolphins?
Answers: 3
Biology, 22.06.2019 06:00
Which part of the neuron below is indicated by the arrow, and what is its function? hormones send chemical signals throughout the body to regulate other body processes. hormones are chemical signals that are sent throughout the body to regulate other body processes. hormones send electrical signals throughout the body to regulate other body processes. hormones are electrical signals that are sent throughout the body to regulate other body processes.
Answers: 2
Biology, 22.06.2019 07:50
How are fungi more like an animal? they have a cell wall. they are heterotrophs that absorb their food. they produce seeds and have membrane-bound nucleus. they use sunlight for photosynthesis.
Answers: 1
Biology, 22.06.2019 10:30
In the desert, saguaro cacti, owls, horned lizards, and fire ants all share the same space. which of the following can be considered a population? question 9 options: all plants in the same area all cacti in the same area all species in the same area the lizards and the ants
Answers: 1
Ethyl methane sulfonate is a chemical mutagen that modifies bases in DNA. This agent causes C to be...
Mathematics, 22.10.2021 14:00
Engineering, 22.10.2021 14:00
History, 22.10.2021 14:00
English, 22.10.2021 14:00
Chemistry, 22.10.2021 14:00
Mathematics, 22.10.2021 14:00
Mathematics, 22.10.2021 14:00
English, 22.10.2021 14:00
History, 22.10.2021 14:00
Mathematics, 22.10.2021 14:00
Biology, 22.10.2021 14:00
History, 22.10.2021 14:00