What three cellular components are present in both prokaryotes and eukaryotes? a. ribosomes, chloroplasts, mitochondria
b. nucleus, ribosomes RNA
c. RNA, DNA,
d. endoplasmic reticulum, DNA, RNA
e. mitochondria, DNA, RNA

According to the theory of punctuated equilibrium, at what rate does speciation occur? species change depending on the rate of natural selection. after periods of stasis, new species evolve relatively rapidly. species change slowly and eventually form new species. some species change quickly and others change slowly to balance the overall rate.

What is thought to have caused the mass extinction at the end of the cretaceous period?

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?