Biology, 09.09.2020 23:01 brizz1502

A chemical equation is that scientists use to describe a chemical reaction.

Answers: 1

Show answers

Another question on Biology

Biology, 21.06.2019 18:50

Football players often sustain lateral blows to the extended knee. which of the ligaments is (are) damaged as a result? a. suprapatellar b. oblique popliteal and extracapsular ligament c. medial collateral, medial meniscus, and anterior cruciate d. arcuate popliteal and the posterior cruciate

Answers: 2

Answer

Biology, 22.06.2019 03:30

The graph below compares the rates of reaction of a burning candle and an exploding firework. comparing chemical reactions what can you conclude from the graph? the reaction that causes a firework to explode requires less energy to start, and occurs more rapidly than the reaction that causes a candle to burn. the reaction that causes a firework to explode requires less energy to start, and occurs less rapidly than the reaction that causes a candle to burn. the reaction that causes a firework to explode requires more energy to start, and occurs less rapidly than the reaction that causes a candle to burn. the reaction that causes a firework to explode requires more energy to start, and occurs more rapidly than the reaction that causes a candle to burn. mark this and return

Answers: 2

Answer

Biology, 22.06.2019 10:30

Which of the following statements is accurate about evolution? question 10 options: natural selection only eliminates odd individuals. evolution means that a population never has changes in its genetic frequencies. mutations are always harmful. evolution means that a population undergoes changes in its gene frequencies over time.

Answers: 1

Answer

Biology, 22.06.2019 12:00

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Answers: 1

Answer

You know the right answer?

A chemical equation is that scientists use to describe a chemical reaction....

Questions