subject
Biology, 20.09.2020 04:01 leandrogarin37p2g5ds

Which statement does NOT describe a scientific theory? A)
A scientific theory can never be proven
B)
A scientific theory is supported by facts
0)
A scientific theory eventually becomes a fact
D)
A scientific theory is a generally accepted explanation

ansver
Answers: 2

Another question on Biology

question
Biology, 22.06.2019 03:20
Which of the following statements most accurately describes convergent evolution? the process in which two similar species evolve separately from each other and share similar characteristics the process in which a single species evolves into two or more new species the process in which two entirely different species evolve in response to each other the process in which two different species evolve separately from each other but still share similar characteristics
Answers: 3
question
Biology, 22.06.2019 04:20
Do you think the gene eef1 alpha1 supports cell theory? explain your response.
Answers: 2
question
Biology, 22.06.2019 06:20
Restless tectonic plates move (shift) between one and fifteen centimeters per year month day minute
Answers: 2
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Which statement does NOT describe a scientific theory? A)
A scientific theory can never be pr...
Questions
question
Mathematics, 29.10.2020 20:20
question
Biology, 29.10.2020 20:20
question
Mathematics, 29.10.2020 20:20
Questions on the website: 13722361