A scientist conducted an investigation about the effects of diet on disease resistance in mice and made surprising observations. The mice with a genetic ear mutation seemed to show similar patterns of resistance compared to mice with normal ears. Based on this information, what will the scientist most likely do next? She will perform a second investigation on the role of certain genes in disease resistance.
She will revise her hypothesis to pertain to mutations rather than diet, and update her data accordingly.
She will use this information to determine that her original question was nonscientific, so she will revise it.
She will determine that her hypothesis was not supported because resistance must be genetic.

All living organisms are composed of a. only one cell. b. at least 100 cells. c. at least three cells. d. one or more cells.

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

As molecules are formed from metabolism, entropy __ and the universe becomes less disordered. a. is decreased b. is increased c. moves closer to equilibrium d. is unchanged