subject
Biology, 23.08.2019 03:00 amontes189gmialcom

When is dehydration synthesis used?

ansver
Answers: 1

Another question on Biology

question
Biology, 21.06.2019 22:30
What are the result of when individual components in an organism interact with others to create noval stucture and function called
Answers: 2
question
Biology, 22.06.2019 03:20
Jasmine, at 33 months of age, is able to engage in some self-care behaviors but still has trouble with tasks such as putting on socks. a few months later, she accomplishes this same task relatively easily. the change in abilities is most likely due to
Answers: 3
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 14:30
Asegment id dna that is artificially created from two or more organism through use of dna enzymes in a laboratory is called a segment of dna that is artificially created from two or more organisms through use of dna enzymes in a laboratory is called
Answers: 1
You know the right answer?
When is dehydration synthesis used?...
Questions
question
Arts, 18.12.2020 01:00
question
Biology, 18.12.2020 01:00
question
Physics, 18.12.2020 01:00
question
English, 18.12.2020 01:00
question
Mathematics, 18.12.2020 01:00
Questions on the website: 13722362