subject
Biology, 16.10.2020 20:01 eamccoy1

HELP PLEASE IM GONNA DIE IF I DONT PASS! To find the epicenter of an earthquake, a seismologist needs to know

Question 22 options:

the epicenter distance from 10 seismic stations.

the intersection of two circles from two seismographic stations.

the distances from three different seismic stations to the epicenter.

the difference in the arrival times of the P- and S-waves at a single seismic station.

ansver
Answers: 3

Another question on Biology

question
Biology, 22.06.2019 00:30
Explain light independent reactions
Answers: 1
question
Biology, 22.06.2019 06:00
Most animal cells membranes have proteins that pump ions out of the cell and potassium ions into the cell
Answers: 3
question
Biology, 22.06.2019 10:30
Natural selection changes allele frequencies because some survive and reproduce more successfully than others.
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
HELP PLEASE IM GONNA DIE IF I DONT PASS! To find the epicenter of an earthquake, a seismologist nee...
Questions
question
History, 18.12.2021 03:20
Questions on the website: 13722367