Biology, 19.10.2020 08:01 bobiscool3698
This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place.
ATTTGCATACTACCGGGC
The letters in bold with a yellow highlight are the noncoding region, and the other letters are the protein coding region.
Group of answer choices
ATTTGCAATACTACCGGGC
ATGAATGCATACTACCGGGC
ATTTGCATACTGACCGGGC
ATTTGCAACTACCGGGC
ATTAGCATACTACGGGC
Answers: 2
Biology, 22.06.2019 04:30
Which phase of the cell cycle ensures that identical copies of the dna are made for daughter cells?
Answers: 1
Biology, 22.06.2019 10:40
Which of the following is the earliest era of earth's geologic time scale? cenozoic mesozoic precambrian paleozoic
Answers: 1
Biology, 22.06.2019 13:00
Plant species a has a diploid number of 12. plant species b has a diploid number of 16. a new species, c, arises as an allopolyploid from a and b. the diploid number for species c would probably be a) 12. b) 14. c) 16. d) 28. e) 56.
Answers: 1
This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the se...
Mathematics, 24.08.2021 02:50
Mathematics, 24.08.2021 02:50
Biology, 24.08.2021 02:50
Mathematics, 24.08.2021 02:50
Mathematics, 24.08.2021 02:50
Mathematics, 24.08.2021 03:00
Mathematics, 24.08.2021 03:00
Social Studies, 24.08.2021 03:00