*MAY* give brainliest!
Please give answer and explain:
This sequence encodes for a par...
Biology, 19.10.2020 08:01 kyandrewilliams1
*MAY* give brainliest!
Please give answer and explain:
This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place.
ATTTGCATACTACCGGGC
The letters in bold with a yellow highlight are the noncoding region, and the other letters are the protein coding region.
Group of answer choices
ATTTGCAATACTACCGGGC
ATGAATGCATACTACCGGGC
ATTTGCATACTGACCGGGC
ATTTGCAACTACCGGGC
ATTAGCATACTACGGGC
Answers: 1
Biology, 21.06.2019 20:10
Which best describes a rhinovirus? o a. a virus that causes a common cold o b. a protective shell around a virus o c. a tube the comes off a virus o d. a piece of dna transferred by a virus
Answers: 1
Biology, 22.06.2019 02:30
What is the inability of an individual or a society to achieve a minimum standard of living known as ?
Answers: 1
Biology, 22.06.2019 03:00
Why do leaves change color in the fall? green pigments break down and no longer mask the color of chlorophyll. chlorophyll breaks down and no longer masks the colors of other pigments. red- and yellow-colored pigments grow and mask green-colored chlorophyll. green-colored chlorophyll breaks down and turns red and yellow.
Answers: 2
Mathematics, 21.05.2020 22:03
Chemistry, 21.05.2020 22:03
Mathematics, 21.05.2020 22:03
Chemistry, 21.05.2020 22:03
Mathematics, 21.05.2020 22:03
English, 21.05.2020 22:03
Mathematics, 21.05.2020 22:03
Mathematics, 21.05.2020 22:03
Computers and Technology, 21.05.2020 22:03