subject

Biology, 19.10.2020 08:01 dflorez3064

MAY give brainliest! Please give answer and explain:

This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place.

ATTTGCATACTACCGGGC

The letters in bold with a yellow highlight are the noncoding region, and the other letters are the protein coding region.

Group of answer choices

ATTTGCAATACTACCGGGC

ATGAATGCATACTACCGGGC

ATTTGCATACTGACCGGGC

ATTTGCAACTACCGGGC

ATTAGCATACTACGGGC

Highlighted letters are: ATACTACC

ansver

Answers: 2

Show answers

Another question on Biology

question

Biology, 21.06.2019 18:00

How is the motion of the particles of water at 80 ⁰c different from the motion of the particles of water when it is 30 ⁰c?

Answers: 1

question

Biology, 22.06.2019 08:30

Which coal field location is related to coal fields in the eastern united states and supports the theory of continental drift? eastern india southern africa western australia northern south america

Answers: 3

question

Biology, 22.06.2019 10:30

Coral have a symbiotic relationship with what in order to eat?

Answers: 2

question

Biology, 22.06.2019 11:00

Need the diagram below, which is not drawn to scale, shows the position of the earth, moon, and sun. what type of eclipse occurs when the earth, moon, and sun are lined up in the order shown? a. planetary eclipse b. solar eclipse c. martian eclipse d. lunar eclipse

Answers: 1

You know the right answer?

*MAY* give brainliest! Please give answer and explain:

This sequence encodes for a part...

Questions

question

English, 22.06.2019 10:30

Jhumpa lahiri uses words depicting her bengali heritage in her literary works. match the bolded words with their meanings in english based on the cont...

question

Mathematics, 22.06.2019 10:30

In the triangle bca, segment bc is congruent to segment ac. if the measure of angle b is 43 degrees what is the measure of angle a...

question

History, 22.06.2019 10:30

What does this population pyramid indicate about denmark's recent population growth? a. it is relatively stable. b. it is rapidly shrinking. c. it is...

question

French, 22.06.2019 10:30

Question 1 (1 point) fill in the blank with the correct future simple conjugation of the verb in parenthesis. only the single word is necessary. "dès...

question

Social Studies, 22.06.2019 10:30

In a the people elect the legislature, and the legislature chooses the head of government. question 5 options: parliamentary democracy communist st...

question

Biology, 22.06.2019 10:30

What is the best conclusion based on this data? the hypothesis was not supported because the data indicated that fertilizing plants does not improve...

question

History, 22.06.2019 10:30

Which of the following resulted from asoka's rule of the mauryan empire? a. the empire gained control over india's southern trade routes. b. an ord...

question

Spanish, 22.06.2019 10:30

Complete the following conversation. eric: ¿cuál es tu fruta favorita? mónica: porque es muy refrescante y tiene vitaminas y minerales. a. la nara...

question

Mathematics, 22.06.2019 10:30

Min is about to roll a six-sided number cube. what is the experimental probability that she will roll an even number based on her previous trials?...

question

History, 22.06.2019 10:30

Based on what you have learned, why would victories in the western theater have been important to the union?...

question

Biology, 22.06.2019 10:30

Why is taking care of yourself a time management techique...

question

History, 22.06.2019 10:30

Use the passage to answer the question. blessed are the meek, for they shall inherit the earth. blessed are those who hunger and thirst for righteousn...

question

Chemistry, 22.06.2019 10:30

Great amounts of electromagnetic energy from our sun and other bodies in space travel through space. which is a logical conclusion about these electro...

question

Chemistry, 22.06.2019 10:30

Great amounts of electromagnetic energy from our sun and other bodies in space travel through space. which is a logical conclusion about these electro...

question

History, 22.06.2019 10:30

Select the correct answer. how did powerful families such as the medici and the sforza spread renaissance ideas? a. they provided financial support...

question

Mathematics, 22.06.2019 10:30

The prism-shaped roof has equilateral triangular bases. create an equation that models the height of one of the roof's triangular bases in terms of it...

question

Chemistry, 22.06.2019 10:30

What determines the average kinetic energy of the particles in a gas? a. the number of collisions b. the number of particles c. the size of the parti...

question

Biology, 22.06.2019 10:30

Which could be a pathway of food through an ecosystem...

question

Business, 22.06.2019 10:30

What are the positive environmental trends seen today? many industries are taking measures to reduce the use( _gold, carbon dioxide, ozone_) of -depl...

question

Mathematics, 22.06.2019 10:30

Which is the equation of a parabola with vertex (0, 0) and focus (0, 2)? a. y^2 = 8x b. y^2 = 4x c. x^2 = 8y d. x^2 = 4y...

More questions: Biology Another questions

Questions on the website: 13722362