Hep pl In an mRNA sequence in the following order:
CGUAUGGGCUUACUAGUCUAAC
A: What is the first anticodon to enter the P position?
B. What is the first anticodon to enter position A?
C_ What is the last codon that enters the P position?

Populations of blue-winged warblers, a type of bird, migrate south in the winter and return to canadian breeding grounds in the spring. as global temperatures have increased due to climate change, spring has started arriving in the warbler's breeding grounds earlier in the year, before the warblers return. warblers now arrive at their breeding grounds too late to select ideal nesting sites and to feed on important early-spring food sources how are populations of blue-winged warblers most likely to be affected by the earlier arrival of spring? o a. populations will go extinct since the warblers will stop migrating to breeding grounds. b. populations will be unaffected since most species can quickly adapt to effects of climate change. c. populations will increase since warmer temperatures are generally beneficial to survival, d. populations will decline since individuals will be less likely to successfully reproduce, reset next

How many species of living things are alive on earth today? more than 1,000,000 none of these answers are correct 100-500 1,000 –500,000 o 500,000 -1,000,000

Acceleration is a direct result of a.) balanced forces b.) unbalanced forces c.) gravity d.) velocity hurry!