Biology, 20.10.2020 01:01 christyr2002
Explain what is happening in this photo in terms of kinetic energy and potential energy. Include the energy conversions that occur when the penguins eat fish and climb back up on the glacier. Describe the role of ATP and enzymes in the underlying molecular processes, including what happens to the free energy of some of the molecules involved.
Answers: 3
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 15:20
What is required in the genotype of an individual to show a recessive trait? a.two recessive alleles b.at least one recessive allele c.no recessive alleles
Answers: 2
Biology, 22.06.2019 18:00
1. you serve a volleyball with a mass of 2.1 kg. the ball leaves your hand with a speed of 30 m/s. the ball has energy. calculate it. 2. a baby carriage is sitting at the top of a hill that is 21 m high. the carriage with the baby weighs 12 n. the carriage has energy. calculate it. 3. a car is traveling with a velocity of 40 m/s and has a mass of 1120 kg. the car has . calculate it.
Answers: 1
Explain what is happening in this photo in terms of kinetic energy and potential energy. Include the...
Mathematics, 26.07.2019 17:30
Mathematics, 26.07.2019 17:30
Social Studies, 26.07.2019 17:30
Mathematics, 26.07.2019 17:30
English, 26.07.2019 17:30
Business, 26.07.2019 17:30
Biology, 26.07.2019 17:30
Mathematics, 26.07.2019 17:30