subject
Biology, 22.10.2020 21:01 aliviafrancois2000

Most organisms are known by their common names, which vary by region and language. They also have scientific names based on their classification. How are
scientific names determined?

ansver
Answers: 2

Another question on Biology

question
Biology, 21.06.2019 19:30
What effect does plate tectonics have an organic evolution
Answers: 1
question
Biology, 22.06.2019 00:00
As a small change in a person's dna can cause a genetic disorder
Answers: 1
question
Biology, 22.06.2019 05:50
Each hereditary trait corresponds to
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Most organisms are known by their common names, which vary by region and language. They also have s...
Questions
question
Mathematics, 13.01.2021 18:50
question
Chemistry, 13.01.2021 18:50
question
Mathematics, 13.01.2021 18:50
question
Mathematics, 13.01.2021 18:50
question
Mathematics, 13.01.2021 18:50
Questions on the website: 13722361