Biology, 29.01.2020 13:48 needhelpwithHW10
Astudent is testing to see how exercise affects heart rate. one group of students sits without exercising; one group of students runs; and one group of students swims. all students have their heart rates measured immediately before and after the session. is this a controlled or comparison experiment?
Answers: 2
Biology, 21.06.2019 15:50
Each trait of a plant is determined a. an allele b. one gene c. a pair of genes d. one dominant gene
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 16:00
Is a measure of the resistance to flow. a high liquid has a high resistance to flow and flows slowly. the ancients thought everything in the world was made of 4 we now know that there are 94 naturally occurring and scientists have created another 24 i am certain they will create even more. honey flows slowly because it has a high to flowing. a can be separated by physical means because it contains more than one pure substance and 2 pure substances are not chemically bonded to each other. a cannot be separated by physical means. all matter is made up of all elements are with the same number of protons. if it is just a single or many bonded together, if all of them have the same number of protons, it is an element. in a piece of pure iron metal, all the are joined together, that piece of iron metal is called elemental iron. a single of iron is called elemental iron. a mixture has differences from place to place. we might need a microscope to see them or they might be obvious to the unaided eye. there are surfaces separating it into different phases. a mixture is the same everywhere. it is uniform. there are no surfaces separating it into different phases. if different kinds of atoms (different elements) are bonded together by their electrons, it is called a there are physical means of to isolate the different pure substances in a mixture and there are chemical means of to isolate the different elements in a compound. 1. element 2. compound 3. mixture 4. heterogeneous 5. homogeneous 6. pure substance 7. atoms 8. separation 9. viscosity 10. resistance
Answers: 3
Astudent is testing to see how exercise affects heart rate. one group of students sits without exerc...
English, 09.10.2021 08:40
Advanced Placement (AP), 09.10.2021 08:40
Mathematics, 09.10.2021 08:40
English, 09.10.2021 08:40
Mathematics, 09.10.2021 08:40
Mathematics, 09.10.2021 08:40
Chemistry, 09.10.2021 08:40