Biology, 27.10.2020 19:40 hdjsjfjruejchhehd
Which statement tells an advantage of multicellular organisms?
A. All of the cells are the same.
B. They can form complex organ systems.
C. One cell performs all of the necessary functions.
D. They can reproduce quickly.
Answers: 3
Biology, 22.06.2019 02:00
Identify the terms using the following picture. principle of dominance item 1 can be described as the . item 2 can be described as the . the "p" represents from one parent.
Answers: 3
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 23.06.2019 04:00
In a hardy-weinberg population with two alleles, a and a, that are in equilibrium, the frequency of allele a is 0.1. what is the frequency of individuals with aa genotype? a) 0.42b) 0.20c) 0.32d) 0.81
Answers: 1
Which statement tells an advantage of multicellular organisms?
A. All of the cells are the same.
History, 27.01.2020 22:31
English, 27.01.2020 22:31
English, 27.01.2020 22:31
Mathematics, 27.01.2020 22:31
English, 27.01.2020 22:31