Biology, 29.10.2020 16:10 jorozco3209
How does denaturation affect the active site of an enzyme? #1 It alters the primary structure of the protein, shortening the sequence of amino acids so that substrate molecules cannot bind to it. #2 It alters the three-dimensional structure of the protein so that substrate molecules cannot bind to it. #3 It alters the quaternary structure of the protein by adding a new polypeptide chain to the active site so that substrate molecules cannot bind to it. #4 It alters the secondary structure of the protein, converting alpha helices into beta pleated sheets so that substrate molecules cannot bind to it.
Answers: 1
Biology, 22.06.2019 02:00
What is an endocrine function? (apex) a.esophageal glands release mucus into the esophagus b.salivary glands release saliva into mouth c.swear glands release sweat to the skin d.the pineal gland releases melatonin into the bloodstream
Answers: 1
Biology, 22.06.2019 06:30
Which statement describes a way in which the digestive and excretory systems work together? a. the nephrons absorb nutrients from food going to the large intestine. b. the excretory system balances blood gases in the small intestine. c. the intestinal villi filter blood and send wastes to the bladder. d. the excretory system balances the salts and water obtained from digested food
Answers: 1
Biology, 22.06.2019 11:00
Membrane vesicles containing an internal sodium chloride (nacl) concentration of 0.14 m are placed into separate beakers each containing a different solution. the first beaker contains 0.14 m sucrose, while the second beaker contains 0.14 m calcium chloride (cacl2). the temperature is 25°c. what is the solute potential inside the vesicles, expressed in units of mpa?
Answers: 2
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
How does denaturation affect the active site of an enzyme? #1 It alters the primary structure of the...
World Languages, 19.02.2021 18:30
English, 19.02.2021 18:30
Mathematics, 19.02.2021 18:30
Geography, 19.02.2021 18:30
English, 19.02.2021 18:30
Mathematics, 19.02.2021 18:30
History, 19.02.2021 18:30
Mathematics, 19.02.2021 18:30
Mathematics, 19.02.2021 18:30
Mathematics, 19.02.2021 18:30
History, 19.02.2021 18:30
Mathematics, 19.02.2021 18:30
Mathematics, 19.02.2021 18:30