Below is a partial mRNA sequence. Use it to answer the following questions. 5' - UGGUCGGCGAGAACGAAAGCGC - 3'
Encoded within the partial mRNA sequence is a region of the protein with the amino acid sequence (N-term...G-E-N-E-S...C-term).
What is the correct reading frame for this mRNA? (Note that the reading frame may not begin with the first base in the partial sequence. It may be necessary to view codons further downstream to find the amino acid sequence N-term...G-E-N-E-S...C-term.)
1. 5' - U | GGU | CGG | CGA | GAA | CGA | AAG | CGC | - 3'
2. 5' - | UGG | UCG | GCG | AGA | ACG | AAA | GCG | C - 3'
3. 5' - UG | GUC | GGC | GAG | AAC | GAA | AGC | GC - 3'
4. 5' - UGGU | CGGC | GAGA | ACGA | AAGC | GC - 3'