Biology, 12.11.2020 06:00 Bladedrose2351
GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTA GAAG How many proteins were
Answers: 2
Another question on Biology
Biology, 21.06.2019 18:00
Ecosystems involve living organisms interacting with non-living things in a productive way; how is photosynthesis an example of this? answer, i will give brainiest to first person to get it right.
Answers: 1
Biology, 22.06.2019 03:50
Which statement about the pancreas is not true? a. it is an endocrine organ in the abdomen. b. it release chemicals into the digestive system. c. it releases insulin to increase glucose levels. d. it release hormones into the bloodstream.
Answers: 1
Biology, 22.06.2019 04:00
1) strawberry plants typically reproduce by making runners, which are miniature versions of themselves, that grow off of the roots and stems of the parent. this type of vegetative reproduction is known as a) pollination. b) fragmentation. c) binary fission. d) vegetative propogation.
Answers: 2
You know the right answer?
GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the enti...
Questions
Physics, 29.09.2020 01:01
History, 29.09.2020 01:01
Mathematics, 29.09.2020 01:01
Mathematics, 29.09.2020 01:01
Mathematics, 29.09.2020 01:01
History, 29.09.2020 01:01
Mathematics, 29.09.2020 01:01
Mathematics, 29.09.2020 01:01
Mathematics, 29.09.2020 01:01
