Biology, 16.11.2020 23:00 kaylinreed7
True or false cells gain and lose different genes during embryonic development, so each cell in an adult only has some genes from the original set. explain
Answers: 3
Biology, 22.06.2019 04:30
Plz fast biotechnology is a growing field of applied biology. many crops such as corn have been engineered to be resistant to herbicides. therefore farmers can spray these chemicals to kill weeds growing near the crop without worries of killing the crop itself how does this type of biotechnology work? a. by changing the genetic make up of the crops. b. by causing the crops to kill the weeds. c. by changing the type of crops used. d. by changing the location of the crops.
Answers: 1
Biology, 22.06.2019 09:10
Hormones are chemical molecules produced by endocrine glands. one such endocrine gland is the thyroid gland, which synthesizes the thyroid hormone, which in turn affects the heart muscles. which two statements describe the probable reason for the function of the hormone? the cells in the heart have specific receptors that allow for the intake of hormones. the heart and the endocrine glands have the exact same types of cells. all cells make the same types of hormones. thyroid hormones show their effect on the heart by means of specialized cells. thyroid cells and cardiac cells have different dna.
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 13:30
Stem cells found adult tissue such as in bone marrow brain muscle skin and liver are only capable of what
Answers: 1
True or false
cells gain and lose different genes during embryonic development, so each cell in an...
English, 14.05.2021 19:20
Mathematics, 14.05.2021 19:20
History, 14.05.2021 19:20
Mathematics, 14.05.2021 19:20
Mathematics, 14.05.2021 19:20
Mathematics, 14.05.2021 19:20
Mathematics, 14.05.2021 19:20
History, 14.05.2021 19:20
Arts, 14.05.2021 19:20