A resource that humans can use to produce
energy is...
Answers: 2
Biology, 22.06.2019 08:50
Blood stem cells may develop into any kind of human blood cells. what kind of stem cells are blood stem cells? a. multipotent stem cells o b. totipotent stem cells o c. pluripotent stem cells o d. unipotent stem cells
Answers: 1
Biology, 22.06.2019 11:00
Which statement correctly describes other ways in which nebulae and stars are different? a. a star always has a higher density than a nebula. b. stars can form inside a nebula but a nebula can never be produced by any star. c. stars can never form inside a nebula but a nebula can be produced by any star. d. a nebula always has a higher density than a star. reset submit
Answers: 3
Biology, 22.06.2019 11:50
Which of the following describes how binary fission and mitosis are similar? a)they are both used for growth or repair b)they both break down membrane-bound nuclei c)both invoke the replication of a single stand of dna d)both replicate genetic material
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Mathematics, 19.03.2021 02:10
Mathematics, 19.03.2021 02:10
Business, 19.03.2021 02:10
Mathematics, 19.03.2021 02:10
Spanish, 19.03.2021 02:10
Advanced Placement (AP), 19.03.2021 02:10
History, 19.03.2021 02:10
Mathematics, 19.03.2021 02:10