Help me plz i’ll give u hugs
...
Answers: 2
Biology, 21.06.2019 14:20
First problem: for each of the following sequences, fill in the mrna sequence, the amino acid sequences, and the rrna anticodonsthat have been left blank.a) dna: atácga aatcgcgatcgcggcgattoggb) mrna: ? c)codon: ? d)anticodon: ? e)amino acids: ? second problem: see abovea) dna: titaoggccatgaggga a tagtig gillarib)mrna: ? c) codon: ? d)anticodon: ? e) amino acids: ? third problem: see abovea) dna: tacgggcctat acgctactactca tgsatcggb) mrna: ? c)codon: ? d)anticodon: ? e)amino acids: ?
Answers: 2
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 16:40
An alaskan spruce forest will burn easily once burned the forest regenerates fairly wuickly which statement best describes haw an alaskan spruce forest reacts to fire? it is resilient
Answers: 1
Biology, 22.06.2019 20:30
Our planet has experienced five major extinctions in the four billion year history of life. the first, 450 million years ago, occurred shortly after the evolution of the first land-based plants and 100 million years after the cambrian explosion. the second extinction occurred 350 million years ago, causing the formation of coal forests. next earth experienced two mass extinctions during the triassic period, between 250 and 200 million years ago. the fifth mass extinction occurred 65 million years ago, ending the reptilian dominance of the earth. according to richard leakey, the sixth mass extinction is happening right now. leakey suggests that we, the human race, are the cause. each year, at our hand, approximately 50,000 species vanish from earth. he believes that man is destroying earth at a rate comparable with the impact of a giant asteroid. leakey's statistics indicate that 50% of earth's species will become extinct within the next 100 years assuming leakey's hypothesis of a sixth mass extinction to be true, how will we expect the model to change? a) a sharp spike in the graph approximately 100 million years from now b) a dip in the graph, followed by a sharp spike about 100 million years from now c) a sharp spike in the graph immediately following the "0" location of the x axis d) a plateau following the "0" mark on the x axis, followed by a gradual rise to a new peak
Answers: 3
Mathematics, 02.10.2020 15:01
Mathematics, 02.10.2020 15:01
Mathematics, 02.10.2020 15:01
History, 02.10.2020 15:01
Biology, 02.10.2020 15:01
Social Studies, 02.10.2020 15:01
Mathematics, 02.10.2020 15:01
Biology, 02.10.2020 15:01
History, 02.10.2020 15:01
Mathematics, 02.10.2020 15:01
Mathematics, 02.10.2020 15:01
Chemistry, 02.10.2020 15:01
Biology, 02.10.2020 15:01