You will create a molecular clock model for an arthropod gene. Using this sample model as a guide, create a molecular clock model. Use the flowchart tools in your word processing program to make your model. Make sure the mutations are clearly visible in the strand. Consider using a different font color for the mutations. Use the Insert Image button to insert a screenshot of your model in the answer space provided.

Which list is in order from simplest to most complex? a bacteria - virus - plant - protist b protist - bacteria - virus - plant c virus - bacteria - plant - protist d virus - bacteria - protist - plant

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Need asap plz hurry im being timed when a body cell divides through the process of mitosis, the chromosomes in the daughter cells a. represent only the healthiest chromosomes from the parent cell. b. represent only half of the chromosomes in the parent cell. c. are identical to the chromosomes of the parent cell. d. are formed when chromosomes from the parent cell cross over.