El estomago de la estrella ¿parece alatamente doblada y extrensible?

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Suppose you are provided with an actively dividing culture of e. coli bacteria to which radioactive thymine has been added. what would happen if a cell replicates once in the presence of this radioactive base?

Dna, in the nucleus carries the genetic code for making proteins in ribosomes. in the diagram, b, represents the proteins produced. dna cannot leave the nucleus to carry the genetic information to the ribosome where proteins are produced. how does the genetic code get from the nucleus to the ribosome? what does a represent? now