Biology, 23.11.2020 19:40 dathanboyd

Select the correct answer from each drop-down menu. The graph describes the motion of an object. The object moves with from A to B. It from B to C. It moves with from C to D.

Answers: 3

Show answers

Another question on Biology

Biology, 21.06.2019 22:00

Protein synthesis actually begins in the nucleus when transcribes a single gene on the dna molecule is copied. the process of copying this gene is called this copy is known as and contains the protein building instructions. this copy is sent out into the cytoplasm to the part of the cell known as the the of the ribosome will join together to form a functional ribosome when they attach to the mrna. as the mrna moves through the ribosome, the message is read by transfer rna brings the correct back to the ribosome. the amino acids are placed in the correct order and are hitched together by

Answers: 3

Answer

Biology, 22.06.2019 02:30

{answer found. it's (3 ) }which statement describes the cell cycle? (1)the cell cycle is a process in which one cell divides into four genetically different cells. (2)the cell cycle is a process in which one cell divides into two genetically different cells. (3)the cell cycle is a process in which one cell divides into two genetically identical cells. (4)the cell cycle is a process in which one cell divides into four genetically identical cells.

Answers: 1

Answer

Biology, 22.06.2019 02:30

The idea that all living things are made up of cells is considered scientific law. this means the idea is an emerging scientific idea that has a logical explanation. has been tested with similar results at least twice. is supported by scientific consensus and a large amount of evidence. has been rejected only once by the scientific community

Answers: 1

Answer

Biology, 22.06.2019 12:00

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Answers: 1

Answer

You know the right answer?

Select the correct answer from each drop-down menu. The graph describes the motion of an object. The...

Questions