subject
Biology, 30.11.2020 22:30 firdausmohammed80

what are the possible consequences to an organisms when the temperature becomes colder than the optimal range for a species

ansver
Answers: 3

Another question on Biology

question
Biology, 22.06.2019 01:00
Nucleic acid certain protein cell membranes certain carbohydrates
Answers: 1
question
Biology, 22.06.2019 04:00
Asap indicate the coat color and the proportion of offspring with that color for each of the following crosses of rabbits. assume all are homozygous. alleles: a=agouti, c=chinchilla, a=albino, a is dominant over c and a, c is dominant over a agouti x chinchilla a) 1/2 chinchilla, 1/2 agouti b) 3/4 chinchilla, 1/4 agouti c) all agouti
Answers: 1
question
Biology, 22.06.2019 10:00
Which of the following human activities resulted in the growth of the north american deer population?
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
what are the possible consequences to an organisms when the temperature becomes colder than the opti...
Questions
question
Mathematics, 04.06.2021 01:00
question
Chemistry, 04.06.2021 01:00
question
Social Studies, 04.06.2021 01:00
Questions on the website: 13722367