Biology, 02.12.2020 16:00 tggfjhzf

Given reason the base of a building is made wider

Answers: 2

Show answers

Another question on Biology

Biology, 21.06.2019 21:10

Zoe decided to measure the hand length of each of her classmates. first she marked a line across each student's wrist and lined up a ruler from this mark to the top of the middle finger to measure the length. then she recorded the measurements in the table below. marla did this the same way for each classmate, and then zoe used this ruler to measure each straight line and record the data below. this data is invalid. what is the most likely reason why it is invalid? the ruler is marked in centimeters, but zoe recorded data in inches. the range of lengths is too wide, so zoe must have misread the ruler. marla’s complicated measuring procedure was overly confusing. marla could have been inconsistent while drawing outlines of fingers.

Answers: 3

Answer

Biology, 22.06.2019 03:50

2. how does the miller-urey experiment fall short of demonstrating that life can arise from inorganic molecules? explain. a. it doesn't show a leap between a collection of amino acids and a single-celled organism. b. it recreates the conditions that existed at the earth's beginning, but no molecules form as a result. c. it doesn't provide evidence of the formation of amino acids. d. it doesn't show how multicellular organisms developed from unicellular organisms

Answers: 2

Answer

Biology, 22.06.2019 10:30

Which of the following statements is accurate about evolution? question 10 options: natural selection only eliminates odd individuals. evolution means that a population never has changes in its genetic frequencies. mutations are always harmful. evolution means that a population undergoes changes in its gene frequencies over time.

Answers: 1

Answer

Biology, 22.06.2019 12:00

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Answers: 1

Answer

You know the right answer?

Given reason the base of a building is made wider...

Questions