![subject](/tpl/images/cats/biologiya.png)
Robert is studying a long list of letters. The letters represent the order of nitrogenous bases in a molecule of mRNA. The first several bases in the list are shown below.
AUGCCACAGGUUCAUCCGAA…
To identify the amino acid sequence encoded by the mRNA, which would be the most useful first step for Robert to follow?
A. Calculate the frequencies of each letter.
B. Count the number of letters in the list.
C. Separate the list into three-letter "words."
D. Separate the list into two-, three- and four-letter "words."
![ansver](/tpl/images/cats/User.png)
Answers: 3
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 18:30
The gene that causes sickle-cell disease is present in a higher percentage of residents of sub-saharan africa than among those of african descent living in the united states. even though this gene causes sickle-cell disease, it also provides some protection from malaria, a serious disease that is widespread in sub-saharan africa but absent in the united states. discuss an evolutionary process that could account for the different percentages of the sickle-cell gene among residents of the two regions.
Answers: 3
![question](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 20:00
Over the past 60 years, many amphibian species have experienced significant population declines and some species have become extinct. scientists suspected that local human activities such as the destruction of wetlands, regional pollution, and deforestation were the main reasons for these losses. however, research over the past 20 years reveals significant amphibian population declines in protected areas of the world, such as nature preserves and parks. these global declines suggest widespread problems including increased ultraviolet radiation, acid rain, and disease. in switzerland, for example, 14 of the 20 native amphibian species are threatened with extinction. chytridiomycosis is a fungal disease first identified in 1998 as a cause of massive amphibian deaths. in some severely impacted populations, a few individuals have survived, perhaps because of some natural resistance. if these resistant individuals continue to survive and prosper, new resistant populations might emerge. this would be an example of the founder effect artificial selection genetic drift natural selection sexual selection
Answers: 3
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 06:30
Mitosis creates two identical daughter cells from one parent cell creates four nonidentical daughter cells from one parent cell is the most common type of reproduction for bacteria is the process by which male and female reproductive cells are created
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 11:00
Membrane vesicles containing an internal sodium chloride (nacl) concentration of 0.14 m are placed into separate beakers each containing a different solution. the first beaker contains 0.14 m sucrose, while the second beaker contains 0.14 m calcium chloride (cacl2). the temperature is 25°c. what is the solute potential inside the vesicles, expressed in units of mpa?
Answers: 2
You know the right answer?
Robert is studying a long list of letters. The letters represent the order of nitrogenous bases in a...
Questions
![question](/tpl/images/cats/mat.png)
Mathematics, 02.04.2020 03:34
![question](/tpl/images/cats/mat.png)
Mathematics, 02.04.2020 03:34
![question](/tpl/images/cats/pravo.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/health.png)
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/fizika.png)
![question](/tpl/images/cats/himiya.png)
![question](/tpl/images/cats/istoriya.png)
History, 02.04.2020 03:34
![question](/tpl/images/cats/health.png)
![question](/tpl/images/cats/health.png)
Health, 02.04.2020 03:34
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/geografiya.png)
![question](/tpl/images/cats/informatica.png)
Computers and Technology, 02.04.2020 03:34
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 02.04.2020 03:34