16. Create the complimentary strand for the DNA strand below. Make sure to label the parts and direction of the strand
5' - AACGGTCCAGTCCAAGTTACG - 3

Subduction zones form when an oceanic plate collides with another oceanic plate or continental plate. the continental crust is lighter and less dense than oceanic crust. continental crust's density is approximately 2.7 grams per cubic centimeter. oceanic crust is thinner and the average density is about 3.3 cubic centimeters. when the two crustal plates converge the oceanic plate always bends and subducts beneath a continental plate. once the oceanic crust subjects, the rocks are subjected to changes in heat and pressure. because of this, we would expect to find rocks in the area of a subduction. a) clastic b) igneous c) metamorphic d) sedimentary