PLEASE help me with this I have 1h left
...
Answers: 1
Biology, 22.06.2019 08:00
Immature bone cells, or osteoblasts, manufacture a protein called osteoid as well as several hormones. because of this, we would expect osteoblasts to contain numerous a) nuclei. b) ribosomes. c) lysosomes. d) golgi bodies.
Answers: 1
Biology, 22.06.2019 09:10
Explain the cellular functions that occur when antibiotics attack a bacteria cell. a. antibiotics target the cell wall, cell membrane, and the processes of protein and nucleic acids production in bacteria to rupture the cell. b. antibiotics create dormant resistant endospores to preserve the genetic material and rupture the cell. c. antibiotics target the cell wall and form a bridge-like connection to form conjugation. d. antibiotics use binary fission to grow twice its size, replications its dna, and split into two cells.
Answers: 2
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 22:00
Which nutritional supplement is correctly paired with the health issue it addresses? which nutritional supplement is correctly paired with the health issue it addresses? vitamin c supplementation prevent depression. calcium supplementation increases iq. vitamin e supplementation prevent birth defects. vitamin b12 can vegans maintain health?
Answers: 3
Mathematics, 30.01.2020 23:01
Geography, 30.01.2020 23:01
Mathematics, 30.01.2020 23:01
Mathematics, 30.01.2020 23:01
Mathematics, 30.01.2020 23:01
Mathematics, 30.01.2020 23:01
Mathematics, 30.01.2020 23:01
English, 30.01.2020 23:01
Computers and Technology, 30.01.2020 23:01
Social Studies, 30.01.2020 23:01
History, 30.01.2020 23:01
Mathematics, 30.01.2020 23:01