Biology, 17.12.2020 19:10 Bassoonist

2H2O a balanced equation

Answers: 2

Show answers

Another question on Biology

Biology, 21.06.2019 17:30

Charles darwin published his theory of evolution in 1859. in what way foes modern evolutionary theory differ from the theory as proposed by darwin? a) darwin inferred that individuals can evolve, but modern generic science has shown that this is not true. b)darwin inferred that individuals do not evolve, but modern genetic science has shown that this is not true. c)modern science has disproved most of darwin's original theory of evolution, because darwin knew nothing about generations and their role in heredity. d)generic studies have shown that gene expression and other factors operate along with natural selection, but most of darwin's theory has been supported by modern science.

Answers: 1

Answer

Biology, 22.06.2019 04:00

Of your good in bio kusing a series of preliminary observations; pstate a problem developed from these observations, formulate a hypothesis, design an experiment to test the hypothesis

Answers: 3

Answer

Biology, 22.06.2019 10:00

How do plants obtain more sunlight a.) they lean towards the light b.)they grow straight up c.) they only live in sunny areas, like the tropics d.) they stay low to the ground

Answers: 2

Answer

Biology, 22.06.2019 12:00

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Answers: 1

Answer

You know the right answer?

2H2O a balanced equation...

Questions