subject
Biology, 30.01.2020 03:48 ggdvj9gggsc

Which organelle modifies cell products, packages them for distribution, and then may turn into vesicles and bubble off the surface of the cell?

ansver
Answers: 1

Another question on Biology

question
Biology, 22.06.2019 06:20
All organisms contribute some water to the water cycle by conducting
Answers: 1
question
Biology, 22.06.2019 10:00
Cladistics is a way of classifying organisms by examining the characteristics of their ancestors and descendants and depicting the relationships in a cladogram. which of the following best describes a challenge in classifying organisms this way? a. there are millions of species on earth, and a cladogram is not a practical means for classifying all of them. b. it is impossible to tell which organisms are most closely related to each other using a cladogram. c. cladograms are detail-oriented and do not provide a useful understanding of evolutionary relationships. d. there is a limited number of ways to organize the information, so most cladograms end up looking very similar.
Answers: 2
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 14:10
Select the correct answer.what is the observable characteristic of a person called? o a. genotypephenotypeoc.alleleo d.gene
Answers: 2
You know the right answer?
Which organelle modifies cell products, packages them for distribution, and then may turn into vesic...
Questions
question
Geography, 02.02.2021 21:30
question
Mathematics, 02.02.2021 21:30
Questions on the website: 13722360