Biology, 01.01.2021 21:40 itsyagirlgona21
Combine two or more sentences in your paragraph for varied syntax.
Review your paragraph for any use of passive voice. Revise those sentences.
Write a short reflection paragraph on the revision process. Describe the changes you made and how these changes improved your writing. Please help i'm stuck and desprate.
Answers: 2
Biology, 22.06.2019 09:50
Which of the following describes the difference in stimuli required to detect a difference between the stimuli? a. just noticeableb. signal detectionc. subliminald. top down
Answers: 2
Biology, 22.06.2019 11:00
Which of these is true of the cytoplasm of an unfertilized egg? a. it is an unevenly distributed mixture of mrna, proteins, organelles, and other substances. b. it does not contain substances that are important in directing development. c. these substances are supplied by the sperm. d. it does not contain substances that are important in directing development. e. development is directed solely by the surrounding cells. f. it is a homogeneous mixture of mrna, proteins, organelles, and other substances. g. it does not contain substances that are important in directing development. h. these substances are produced by the dna of the fertilized zygote.
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 19:00
asap plz when a charge is dropped from a felony to a misdemeanor, which type of plea bargain has happened? ? a. vertical b. horizontal c. avoidance of stigma d. reduced sentence
Answers: 3
Combine two or more sentences in your paragraph for varied syntax.
Review your paragraph for any us...
English, 29.04.2021 01:30
Mathematics, 29.04.2021 01:30
History, 29.04.2021 01:30
French, 29.04.2021 01:30
Mathematics, 29.04.2021 01:30
Mathematics, 29.04.2021 01:30
Mathematics, 29.04.2021 01:30
English, 29.04.2021 01:30
Mathematics, 29.04.2021 01:30
Mathematics, 29.04.2021 01:30
Mathematics, 29.04.2021 01:30