![ansver](/tpl/images/cats/User.png)
Answers: 2
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 21:40
According to the rna world hypothesis, rna acted as the genetic material and catalyzed reactions in ancient cells. what conclusion can you draw from this? a. this implies that dna and proteins aren't essential in cells today. b. this implies that rna can catalyze any chemical reaction that enzymes catalyze. c. this implies that if a cell has a problem with its dna, its rna can compensate for the damaged dna. d. this implies that dna and proteins evolved after rna.
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 23.06.2019 01:30
You are shown 2 samples of the earthes crust . the first is denser than the second . which most likley is oceanic crust
Answers: 3
![question](/tpl/images/cats/biologiya.png)
Biology, 23.06.2019 03:00
Which of the following describe the role a biochemical pump plays in active transport? a it prevents water from moving across the cell membrane. b it uses energy to move materials across the cell membrane against the concentration gradient. c it large molecules cross the cell membrane without using energy. d it a cell move molecules from an area of higher concentration to an area of lower concentration.
Answers: 2
You know the right answer?
What does a food web link together?...
Questions
![question](/tpl/images/cats/mat.png)
Mathematics, 18.11.2020 07:50
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/health.png)
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 18.11.2020 07:50
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/biologiya.png)
Biology, 18.11.2020 07:50
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/obshestvoznanie.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mkx.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 18.11.2020 07:50
![question](/tpl/images/cats/mat.png)
Mathematics, 18.11.2020 07:50
![question](/tpl/images/cats/mat.png)
Mathematics, 18.11.2020 07:50
![question](/tpl/images/cats/geografiya.png)
Geography, 18.11.2020 07:50
![question](/tpl/images/cats/fizika.png)
Physics, 18.11.2020 07:50